View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13838_low_16 (Length: 287)
Name: NF13838_low_16
Description: NF13838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13838_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 10 - 269
Target Start/End: Complemental strand, 5038225 - 5037967
Alignment:
| Q |
10 |
attatactaatattttatgctattcaaaataaattcacatcgcagcaatcacaatatgcatcgcaatagtatagtattgtttaaattgatttctattcac |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5038225 |
attatattaatattttatgctattcaaaataaattcacaccgcagcaatcacaatatgcatcgcaatagtatagtattgtctaaattgatttctattcac |
5038126 |
T |
|
| Q |
110 |
cggttttatgtgatacaattgataaatggtgggacttttaagtatgtgattagagatttaatttagtatctagaaaaattagtattactttttgtttcaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
5038125 |
cggttttatgtgatacaattgataaatggtgggac-tttaagcatgtgattagagatttaatttagcatctagaaaaattagtattactttttgtttcaa |
5038027 |
T |
|
| Q |
210 |
tagagaaaggaatccatgataattcaaagtttaactaatggtcgtttcaaccatagtact |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5038026 |
tagagaaaggaatccatgataattcaaagtttaactaatattcgtttcaaccatagtact |
5037967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University