View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13838_low_28 (Length: 226)
Name: NF13838_low_28
Description: NF13838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13838_low_28 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] scaffold0098 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 226
Target Start/End: Complemental strand, 3886547 - 3886333
Alignment:
| Q |
12 |
gagagagagacgtacggattcgagtttaccgatgagagtagcaacggtggaggtggcttcggagaggatggaagaggtgtcgacaccttcgaggttgacg |
111 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3886547 |
gagagagagacgtacggattcgggtttgccgatgagagtagcaacggtggaggtggcttcggagaggatggaagaggtgtcgacaccttcgaggttgacg |
3886448 |
T |
|
| Q |
112 |
ttggtggagaggttgaggcacggcatcgtttcgatatctctctcttcaaatcactgactgactcggttgtagctacttctttctcttactcaccactggt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3886447 |
ttggtggagaggttgaggcacggcatcgtttcgatatctctctcttcaaatcactgactgactcggttgtagctacttctttctcttactcaccactggt |
3886348 |
T |
|
| Q |
212 |
tgaaaatccaaacct |
226 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
3886347 |
tgaaaatccaaacct |
3886333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0098 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: scaffold0098
Description:
Target: scaffold0098; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 12 - 107
Target Start/End: Complemental strand, 1295 - 1200
Alignment:
| Q |
12 |
gagagagagacgtacggattcgagtttaccgatgagagtagcaacggtggaggtggcttcggagaggatggaagaggtgtcgacaccttcgaggtt |
107 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||| | || |||| | | |||||||||||||||||||||||||||| |||||| |
|
|
| T |
1295 |
gagagagagacgtacggattcgggtttaccgatgagggtagcaatgatgaaggttacattagagaggatggaagaggtgtcgacaccttagaggtt |
1200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University