View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13839_low_10 (Length: 237)
Name: NF13839_low_10
Description: NF13839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13839_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 94 - 221
Target Start/End: Complemental strand, 49411176 - 49411049
Alignment:
| Q |
94 |
tagacgaatacaaagaagaggaaacgttgttcattgtagccaaccatacaaagcgaaaagcaacatggccaagaaaattagcattcatgttcttaacaac |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49411176 |
tagacgaatacaaagaagaggaaacgttgttcattgtagccaaccatacaaagcgaaaagcaacatggccaagaaaattagcattcatgttcttaacaac |
49411077 |
T |
 |
| Q |
194 |
aactcctcttccatttgcttcattatgg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
49411076 |
aactcctcttccatttgcttcattatgg |
49411049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 17 - 59
Target Start/End: Complemental strand, 49411253 - 49411211
Alignment:
| Q |
17 |
atcaaacccaaacctcacaaccactttcttaagtataaatact |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49411253 |
atcaaacccaaacctcacaaccactttcttaagtataaatact |
49411211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University