View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1383_high_11 (Length: 286)
Name: NF1383_high_11
Description: NF1383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1383_high_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 46 - 223
Target Start/End: Original strand, 5970703 - 5970879
Alignment:
| Q |
46 |
aacaatattcaacactcacacacaaagggagaatacaaaaaagagtttcaagtctttttctttttggtataatattcaaagatgaggagtagtagtgatt |
145 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5970703 |
aacaatattcaacactcacacacaaaaggagaatacaaaaaagagtttgaagtctttt-ctttttggtataatattcaaagatgaggagtagtagtgatt |
5970801 |
T |
 |
| Q |
146 |
caaatatgagaggttcaaagaagaaggtgtcatccaaaaagctaggagggtatctcaaagagcaaaaaggaagattat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
5970802 |
caaatatgagaggttcaaagaagaaggtgtcatccaaaaagctaggaggctatctcaaagagcaaaagggaagattat |
5970879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University