View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1383_low_19 (Length: 312)
Name: NF1383_low_19
Description: NF1383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1383_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 133 - 228
Target Start/End: Original strand, 37388933 - 37389028
Alignment:
| Q |
133 |
aggttcacttttgtcgaattcgatcgtatatgtgatggtatagagttgttaatcgttcttgattacggattatggttgaattttagatgattttat |
228 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37388933 |
aggttcacttttgacgaatttgatcgtatatgtgatggtatagagttgttaatcgttcttgattacggattatggttgaattttagatgattttat |
37389028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 52 - 128
Target Start/End: Original strand, 37388800 - 37388876
Alignment:
| Q |
52 |
atatctgtttgtggttcaaggatgtttcacaattaaggattgtcgcatggctttttctctaatttccagaaattggt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37388800 |
atatctgtttgtggttcaaggatgtttcacaattaaggattgtcacatggctttttctctaatttccagaaattggt |
37388876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University