View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1383_low_22 (Length: 279)
Name: NF1383_low_22
Description: NF1383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1383_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 82 - 250
Target Start/End: Original strand, 54275143 - 54275311
Alignment:
| Q |
82 |
gaaaatggattttgggattggcggattgcaaaatatgcagcatgtatgaaaggaggcgtttaaactacaattgcatttatttgcaaatttgggtgtgatc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54275143 |
gaaaatggattttgggattggcggattgcaaaatatgcagcatgtatgaaaggaggcgtttaaactacaattgcatttatttgcaaatttgggtgtgatc |
54275242 |
T |
 |
| Q |
182 |
tatatcctgattgtcattatatcttcatctcaactgtttgatttccatattgatttaacgtgatcatat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54275243 |
tatatcctgattgtcattatatcttcatctcaactgtttgatttccatattgatttaacgtgatcatat |
54275311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 54275037 - 54275116
Alignment:
| Q |
1 |
ctgaaaggggtacattttgtagctgatggaagaactggagcttttaactcattatttgtacttctctatgaccaaatgta |
80 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54275037 |
ctgaaaagggtacattttgtagctgatggaagaactggagcttttaactcattatttgtacttctctatgaccaaatgta |
54275116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University