View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1383_low_24 (Length: 258)
Name: NF1383_low_24
Description: NF1383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1383_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 28 - 257
Target Start/End: Complemental strand, 39092344 - 39092117
Alignment:
| Q |
28 |
catccctgtcagtaggggggtgtgtggccgtgtgcgtttggccatgattggctttgagtgtattttctggtgctctgtgaaagttcaaagagtgtgtttt |
127 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39092344 |
catccctgtcagtagggggttgtgtggccgtgtgcgtttggccatgattggctttgagtgtgttttctgatgctctgtgaaagttcaaagagtgtgtttt |
39092245 |
T |
|
| Q |
128 |
ctggtctttgtcttggttcaaagtgtgtgtgcgtgtctagtatttggtttggtggcttttgtatgatactatgagcatccataacgggagtatatggggt |
227 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
39092244 |
ctggtctctgtcttggttcaaagtgtgtgt--gtgtctagtatttggtttggtggcttttgtatgatactatgagcatccataacgggagtatatggagt |
39092147 |
T |
|
| Q |
228 |
ggatgtggctaattatctttacagtatgtt |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
39092146 |
ggatgtggctaattatctttacagtatgtt |
39092117 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University