View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1383_low_25 (Length: 258)
Name: NF1383_low_25
Description: NF1383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1383_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 35850764 - 35850667
Alignment:
| Q |
1 |
tgtggcattagaattgccgccaccgttagagttgccgccgtcttctggaactattggtgtgccagagaagtatgtttcgtacttgttttcggtatatg |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35850764 |
tgtggcattagaattgccgccaccgttagagttgccgccgtcttctggaactattggtgtgccagagaagtatgtttcgtacttgttttcggtatatg |
35850667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 2 - 98
Target Start/End: Complemental strand, 35841146 - 35841050
Alignment:
| Q |
2 |
gtggcattagaattgccgccaccgttagagttgccgccgtcttctggaactattggtgtgccagagaagtatgtttcgtacttgttttcggtatatg |
98 |
Q |
| |
|
||||||| ||||||| |||| || || ||||| ||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
35841146 |
gtggcatcagaattgtcgccgcctttggagttaccgccgtcttcaggaactattggtgtgccggagaagtatgtttcgtacttgttttcggtatatg |
35841050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University