View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1383_low_37 (Length: 203)
Name: NF1383_low_37
Description: NF1383
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1383_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 55; Significance: 8e-23; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 42 - 104
Target Start/End: Original strand, 32106091 - 32106153
Alignment:
| Q |
42 |
tgtttttatctccttaaaaatagagaacattttttcgttatttgagacggtgatgcgtgtttt |
104 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
32106091 |
tgtttttatctccttaaaattagagaacattttttcgttatttgagacggtgatgcatgtttt |
32106153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 36 - 104
Target Start/End: Original strand, 32076023 - 32076091
Alignment:
| Q |
36 |
gacagatgtttttatctccttaaaaatagagaacattttttcgttatttgagacggtgatgcgtgtttt |
104 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |||||||||||| ||||||| |||||| |
|
|
| T |
32076023 |
gacagatgtttttatctccttaaaattagagaacatttttttgttatttgagactgtgatgcatgtttt |
32076091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 42 - 105
Target Start/End: Original strand, 32088440 - 32088503
Alignment:
| Q |
42 |
tgtttttatctccttaaaaatagagaacattttttcgttatttgagacggtgatgcgtgtttta |
105 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
32088440 |
tgtttttatctccttaaaattagagaacattttttcgttatttgaaacggtgatgcatgtttta |
32088503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 32117232 - 32117264
Alignment:
| Q |
72 |
tttttcgttatttgagacggtgatgcgtgtttt |
104 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
32117232 |
tttttcgttatttgagacggtgatgcatgtttt |
32117264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 32117817 - 32117849
Alignment:
| Q |
72 |
tttttcgttatttgagacggtgatgcgtgtttt |
104 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
32117817 |
tttttcgttatttgagacggtgatgcatgtttt |
32117849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 32120084 - 32120116
Alignment:
| Q |
72 |
tttttcgttatttgagacggtgatgcgtgtttt |
104 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
32120084 |
tttttcgttatttgagacggtgatgcatgtttt |
32120116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University