View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13840_high_16 (Length: 251)
Name: NF13840_high_16
Description: NF13840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13840_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 2 - 233
Target Start/End: Original strand, 43734633 - 43734864
Alignment:
| Q |
2 |
acagggaatggcagtgatgtggttaacagccatgattccacaggcaaggccaccctcttgcaatcatcactcaacagaaaactgccaatctgcaacttcg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43734633 |
acagggaatggcagtgatgtggttaacagccatgattccacaggcaaggccaccctcttgcaatcatcactcaacagaaaactgccaatctgcaacttcg |
43734732 |
T |
 |
| Q |
102 |
tctcaaatagctatactattctcttgttttgctctcatatccattggaggaggtggaatttcatgttccttatcatttggtgccgatcaactcagcgaaa |
201 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
43734733 |
tctcaaatagctataatattctcttgttttgctctcatatccattggaggaggtggaatttcatgttccttatcatttggtgccgatcaactcagcaaaa |
43734832 |
T |
 |
| Q |
202 |
aaaccgatcctaagaatcaaagggtgttggaa |
233 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |
|
|
| T |
43734833 |
aaactgatcctaagaatcaaagggtgttggaa |
43734864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University