View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13840_high_18 (Length: 248)
Name: NF13840_high_18
Description: NF13840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13840_high_18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 62 - 248
Target Start/End: Original strand, 56491773 - 56491959
Alignment:
| Q |
62 |
tctatcaattgtatttcaaagttgnnnnnnnncgcaccaataatctcatgtcatatgaaatttagttcttactctaaataatataaatacttttaacact |
161 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56491773 |
tctatcaattgtatttcaaagttgaaaaaaa-cgcacccataatctcatgtcatatgaaatttagttcttactctaaataatataaatacttttaacact |
56491871 |
T |
 |
| Q |
162 |
tgcatacaattatatttcattattttatcacgatttaaatatgaatcaaaattaataactttttggactg-taaatcatttaattgtt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
56491872 |
tgcatacaattatatttcattattttatcacgatttaaatatgaatcaaaattaataactttttggactgataaatcatttaattgtt |
56491959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University