View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13841_high_28 (Length: 235)
Name: NF13841_high_28
Description: NF13841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13841_high_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 128 - 228
Target Start/End: Complemental strand, 27685117 - 27685017
Alignment:
| Q |
128 |
gtatgaaatgctcaaattaaacaagcatatgttcgtatgaaatgctcaaattaatcggttagactttatttttgggctagtagagcatatagggtagcca |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27685117 |
gtatgaaatgctcaaattaaacaagcatatgttcgtatgaaatgctcaaattaatcggttagactttatttttgggctagtagagcatatagggtagcca |
27685018 |
T |
 |
| Q |
228 |
a |
228 |
Q |
| |
|
| |
|
|
| T |
27685017 |
a |
27685017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 27685264 - 27685192
Alignment:
| Q |
1 |
tgcacaaaaagtttatcacgtttaagatattatttttcacttttgtatttataacaattaaaataaccacaag |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27685264 |
tgcacaaaaagtttatcacgtttaagatattatttttcacttttgtatttataacaattgaaataaccacaag |
27685192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University