View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13841_high_30 (Length: 228)

Name: NF13841_high_30
Description: NF13841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13841_high_30
NF13841_high_30
[»] chr7 (1 HSPs)
chr7 (1-196)||(2672192-2672388)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 2672388 - 2672192
Alignment:
1 tatatttaccataaagagccttaatgttgttatttatattatcacttttgacatttactgttttgtttaagcagataaatggatgattcatcgattactg 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||    
2672388 tatatttaccataaagagccttaatgttgttatttatattatcacttttgacatttactgttttgtctaaacagataaatggatgattcatcgattactg 2672289  T
101 catcttcagtatacggttcgtctagtcagacaaagaaaagaaagactttcaaccaacaatgtctt-gcctacgacgatccatgaaggaagagttgaa 196  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||| |||||||||||||||||||||    
2672288 catcttcactatacggttcgtctagtcagacaaagaaaagaaagactttcaaccaacaatgtattagcctacgacaatccatgaaggaagagttgaa 2672192  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University