View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13841_low_23 (Length: 266)
Name: NF13841_low_23
Description: NF13841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13841_low_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 111 - 253
Target Start/End: Complemental strand, 52268629 - 52268487
Alignment:
| Q |
111 |
tagtcggctgatagcatattgggaatacctacactcaaggtgggattgtacctggtgttggcgctagatttgttaagaacaatgttattttcttgccttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52268629 |
tagtcggctgatagcatattgggaatacctactctcaaggtgggattgtacctggtgttggcgctagatttgttaagaacaatgttattttcttgccttg |
52268530 |
T |
 |
| Q |
211 |
tttgagggaaaagcatgataacccatatatggatgtagtaagt |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52268529 |
tttgagggaaaagcatgataacccatatatggatgtagtaagt |
52268487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 144 - 179
Target Start/End: Complemental strand, 52268676 - 52268641
Alignment:
| Q |
144 |
ctcaaggtgggattgtacctggtgttggcgctagat |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
52268676 |
ctcaaggtgggattgtacctggtgttggcgctagat |
52268641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 73 - 253
Target Start/End: Original strand, 13745516 - 13745694
Alignment:
| Q |
73 |
cctgttaaccatgatctttttcctggaaggtagtcacatagtcggctgatagcatattgggaatacctacactcaaggtgggattgtacctggtgttggc |
172 |
Q |
| |
|
|||||||| || ||||||||| | ||||||||||||| ||||||||||||| |||||||||||| ||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
13745516 |
cctgttaatcaggatcttttttccggaaggtagtcacttagtcggctgataccatattgggaatgcctactctcaaggtg--attgtaccaggtgttggc |
13745613 |
T |
 |
| Q |
173 |
gctagatttgttaagaacaatgttattttcttgccttgtttgagggaaaagcatgataacccatatatggatgtagtaagt |
253 |
Q |
| |
|
|||||||| ||||||||| |||||||| |||||||||||||||||||||||| || |||| || ||| ||| |||||||| |
|
|
| T |
13745614 |
gctagattggttaagaactgtgttatttccttgccttgtttgagggaaaagcaagagaacctatttatagatatagtaagt |
13745694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 4 - 71
Target Start/End: Original strand, 13745499 - 13745566
Alignment:
| Q |
4 |
gatgaagtgttgcataacctgttaaccaggatctttttcccggaaggtagtcacatagtctgctgata |
71 |
Q |
| |
|
|||||| |||||||||||||||||| |||||||||||| ||||||||||||||| ||||| ||||||| |
|
|
| T |
13745499 |
gatgaaatgttgcataacctgttaatcaggatcttttttccggaaggtagtcacttagtcggctgata |
13745566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University