View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13841_low_27 (Length: 238)
Name: NF13841_low_27
Description: NF13841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13841_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 3 - 233
Target Start/End: Complemental strand, 7488043 - 7487811
Alignment:
| Q |
3 |
tatgtgtatatacgttttcatgtcagtctatataaataattattttctctttcaaaacacagcaaataaaattgtttctgaaggattgttttatgcttta |
102 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7488043 |
tatgtgtgtatacgttttcatgtcagtctatataaataatttttttctctttcaaaacacagcaaataaaattgtttctgaaggattgttttatgcttta |
7487944 |
T |
 |
| Q |
103 |
gtaatgagattagttttcatgtattggtggtataaaacctttttagatgcgtatcttatcaaagtgtttctccaaggtacacgagtgtcacttttataaa |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7487943 |
gtaatgagattagttttcacgtattggtggtataaaacctttttacatgcgtatcttatcaaagtgtttctccaaggtacacgagtgtcacttttataaa |
7487844 |
T |
 |
| Q |
203 |
ttgattattttga--tatagattggatatctat |
233 |
Q |
| |
|
|| |||||||||| |||||||||||||||||| |
|
|
| T |
7487843 |
ttaattattttgatatatagattggatatctat |
7487811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University