View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13842_high_17 (Length: 248)
Name: NF13842_high_17
Description: NF13842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13842_high_17 |
 | |
|
| [»] scaffold0252 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 43440541 - 43440400
Alignment:
| Q |
1 |
tggagggatttgttgttcctatgcgcgacacaaacgttgttttttgaagggtttaaggttgaacgaagggtttttgtctagtggacaaaatttaaataat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
43440541 |
tggagggatttgttgttcctatgcgcgacacaaacgttgttttttgaagggtttaaggttgaacgaaggg-ttttgtctagtggtcaaaatttaaataat |
43440443 |
T |
|
| Q |
101 |
tttattatatgtaatgctattattttcaaaagggttaaatatg |
143 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
43440442 |
tttattatatgtaatgctactattttcaaaaggcttaaatatg |
43440400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 38 - 74
Target Start/End: Complemental strand, 43434616 - 43434580
Alignment:
| Q |
38 |
tgttttttgaagggtttaaggttgaacgaagggtttt |
74 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
43434616 |
tgttttttgaagggtttaaggttgaacgatgggtttt |
43434580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0252 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0252
Description:
Target: scaffold0252; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 74
Target Start/End: Complemental strand, 20137 - 20105
Alignment:
| Q |
42 |
ttttgaagggtttaaggttgaacgaagggtttt |
74 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
20137 |
ttttgaagggtttaaggttgaacgatgggtttt |
20105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University