View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13842_low_13 (Length: 355)
Name: NF13842_low_13
Description: NF13842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13842_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 15 - 138
Target Start/End: Original strand, 29021174 - 29021297
Alignment:
| Q |
15 |
aatattattcaatgaacacaccaaagcaatattcaagggtttgtataattaattaggtatcatgttgtttattaatttaatcaccggatagtgttatcga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29021174 |
aatattattcaatgaacacaccaaagcaatattcaagggtttgtataattaattaggtatcatgttgtttattaatttaatcaccggatagtgttatcga |
29021273 |
T |
|
| Q |
115 |
gattgtattatttccgattgcatg |
138 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
29021274 |
gattgtattatttccgattgcatg |
29021297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 187 - 314
Target Start/End: Original strand, 29021337 - 29021462
Alignment:
| Q |
187 |
acattgttgtatcttgtccttactatactctgtagggattatgaagggaattaaaggaaatgaagtgaaaataaatgtgagtaaaaagtaagatgatttt |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29021337 |
acattgttgtatcttgtccttactatactctat--ggattatgaagggaattaaaggaaaggaagtgaaaataaatgtgagtaaaatgtaagatgatttt |
29021434 |
T |
|
| Q |
287 |
acggttgttttgtaggtttagtaaaagt |
314 |
Q |
| |
|
|| ||||||||||| ||||||||||||| |
|
|
| T |
29021435 |
acagttgttttgtatgtttagtaaaagt |
29021462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University