View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13842_low_18 (Length: 248)

Name: NF13842_low_18
Description: NF13842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13842_low_18
NF13842_low_18
[»] chr4 (2 HSPs)
chr4 (1-143)||(43440400-43440541)
chr4 (38-74)||(43434580-43434616)
[»] scaffold0252 (1 HSPs)
scaffold0252 (42-74)||(20105-20137)


Alignment Details
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 43440541 - 43440400
Alignment:
1 tggagggatttgttgttcctatgcgcgacacaaacgttgttttttgaagggtttaaggttgaacgaagggtttttgtctagtggacaaaatttaaataat 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||    
43440541 tggagggatttgttgttcctatgcgcgacacaaacgttgttttttgaagggtttaaggttgaacgaaggg-ttttgtctagtggtcaaaatttaaataat 43440443  T
101 tttattatatgtaatgctattattttcaaaagggttaaatatg 143  Q
    ||||||||||||||||||| ||||||||||||| |||||||||    
43440442 tttattatatgtaatgctactattttcaaaaggcttaaatatg 43440400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 38 - 74
Target Start/End: Complemental strand, 43434616 - 43434580
Alignment:
38 tgttttttgaagggtttaaggttgaacgaagggtttt 74  Q
    ||||||||||||||||||||||||||||| |||||||    
43434616 tgttttttgaagggtttaaggttgaacgatgggtttt 43434580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0252 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0252
Description:

Target: scaffold0252; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 74
Target Start/End: Complemental strand, 20137 - 20105
Alignment:
42 ttttgaagggtttaaggttgaacgaagggtttt 74  Q
    ||||||||||||||||||||||||| |||||||    
20137 ttttgaagggtttaaggttgaacgatgggtttt 20105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University