View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13842_low_21 (Length: 240)
Name: NF13842_low_21
Description: NF13842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13842_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 2 - 239
Target Start/End: Original strand, 50591510 - 50591752
Alignment:
| Q |
2 |
acagacgtggaagaacttggggactggatgaaatcttgtttggagaatcacccattattgaactcttgactgagaaagaacttgaagcagatccggctgt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50591510 |
acagacgtggaagaacttggggactggatgaaatcttgtttggagaatcacccattattgaacttttgactgagaaagaacttgaagcagatccggctgt |
50591609 |
T |
 |
| Q |
102 |
taagcatttaagctctgctactgaagaagggaaagtga-----tgacctgtagtgttgattctcactcttannnnnnnnnagttgaataaaatgtaattt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
50591610 |
taagcatttaagctctgctactgaagaagggaaagtgatgacctgacctgtagtgttgattctcactcttatttttttttaattgaataaaatgtaattt |
50591709 |
T |
 |
| Q |
197 |
gttgatattttccattgggtgattgtatgtctatgtggttatc |
239 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
50591710 |
gttgatattttccattgcgtgattgtatgtctatgtggttatc |
50591752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 2 - 131
Target Start/End: Original strand, 50590406 - 50590536
Alignment:
| Q |
2 |
acagacgtggaagaacttggggactggatgaaatcttgtttggagaatcacccattatt-gaactcttgactgagaaagaacttgaagcagatccggctg |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50590406 |
acagatgtggaagaacttggggactggatgaaatcttgtttggagaatcacccattgtttgaacctttgactgagaaagaacttgaagcagatccggctg |
50590505 |
T |
 |
| Q |
101 |
ttaagcatttaagctctgctactgaagaagg |
131 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |
|
|
| T |
50590506 |
ttaagcttttaagctctgctactgaagaagg |
50590536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University