View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13843_high_1 (Length: 305)
Name: NF13843_high_1
Description: NF13843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13843_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 213 - 290
Target Start/End: Complemental strand, 16146565 - 16146488
Alignment:
| Q |
213 |
tcaagacttttggagataagcttttgtttgtaggtggacaaaggggtccagaaggtgaagaagctgtagtagagtatt |
290 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||||||||| ||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
16146565 |
tcaagatttgtggagataagctgttgtttgtaggtggacaaagtggtccggaaggggaagaagctgtagtagtgtatt |
16146488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 41 - 137
Target Start/End: Complemental strand, 16146676 - 16146580
Alignment:
| Q |
41 |
atcatatttatcacggttctaaagaatgttcaccacttcttgctgtacttaacgattggttgtacacaattgaacgtttaaatagcatgatcaagaa |
137 |
Q |
| |
|
||||||| |||||| |||| |||| |||| |||||||| |||||||| |||| |||| |||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
16146676 |
atcatatatatcacagttcaaaagcatgtccaccacttgttgctgtatttaatgattagttgtaagcaattgaacgtttaactagcatgatcaagaa |
16146580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 213 - 272
Target Start/End: Original strand, 40119334 - 40119393
Alignment:
| Q |
213 |
tcaagacttttggagataagcttttgtttgtaggtggacaaaggggtccagaaggtgaag |
272 |
Q |
| |
|
||||| ||| ||||||||| |||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
40119334 |
tcaaggcttgtggagataaacttttggtcgtaggtggacaaaggggtccagaaggtgaag |
40119393 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University