View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13845_high_5 (Length: 262)
Name: NF13845_high_5
Description: NF13845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13845_high_5 |
 |  |
|
| [»] scaffold0155 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 42394607 - 42394379
Alignment:
| Q |
18 |
agcccaagcccacggcccaattttcaagctcaggcttggtagcaaacttggcatcgtgttaacttcaccttccacagctcgtgaagttctaaaagactat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42394607 |
agcccaagcccacggcccaattttcaagctcaggcttggtagcaaacttggcatcgtgttaacttcaccttccatggctcgtgaagttctaaaagactac |
42394508 |
T |
 |
| Q |
118 |
gacaccgttttcgccaaccgtgatccccctgccgccggaaaagcagctacatacggtggctcagatatatcatggagcccgtacggaccacagtggcgga |
217 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42394507 |
gacaccattttcgccaaccgtgatccccctgccgccggaaaagcagctacatatggtggctcagatatatcatggagcccgtacggaccacagtggcgga |
42394408 |
T |
 |
| Q |
218 |
tgctgaggaaagtttgtggggtgaggatg |
246 |
Q |
| |
|
|||||||||||||||||| ||||| |||| |
|
|
| T |
42394407 |
tgctgaggaaagtttgtgtggtgaagatg |
42394379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 42378692 - 42378486
Alignment:
| Q |
18 |
agcccaagcccacggcccaattttcaagctcaggcttggtagcaaacttggcatcgtgttaacttcaccttccacagctcgtgaagttctaaaagactat |
117 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||| || |||||||| || || || || ||||||||||||||||| || |||||||||||||| | |
|
|
| T |
42378692 |
agcccaagcccacggcccaatttacaagctctggctcggaagcaaactcggtattgttttgacttcaccttccacagcacgccaagttctaaaagaccac |
42378593 |
T |
 |
| Q |
118 |
gacaccgttttcgccaaccgtgatccccctgccgccggaaaagcagctacatacggtggctcagatatatcatggagcccgtacggaccacagtggcgga |
217 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||| | ||| || || ||||| ||| |||||| ||||| ||| ||||| ||||||||||| | |
|
|
| T |
42378592 |
gacacagttttcgccaaccgtgacgtccctgccgccggtagagccgccacttacggcggcaacgatatagtatggaccccctacggtccacagtggcgta |
42378493 |
T |
 |
| Q |
218 |
tgctgag |
224 |
Q |
| |
|
||||||| |
|
|
| T |
42378492 |
tgctgag |
42378486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 42390238 - 42390193
Alignment:
| Q |
18 |
agcccaagcccacggcccaattttcaagctcaggcttggtagcaaa |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42390238 |
agcccaagcccacggcccaattttcaagctcaggcttggtagcaaa |
42390193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0155 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: scaffold0155
Description:
Target: scaffold0155; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 497 - 269
Alignment:
| Q |
18 |
agcccaagcccacggcccaattttcaagctcaggcttggtagcaaacttggcatcgtgttaacttcaccttccacagctcgtgaagttctaaaagactat |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| || ||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
497 |
agcccaaacccacggcccaattttcaagctcaggcttggtagcaaactcggtatcgtcataacttcaccttccacagctcgtgaagttcttaaagactac |
398 |
T |
 |
| Q |
118 |
gacaccgttttcgccaaccgtgatccccctgccgccggaaaagcagctacatacggtggctcagatatatcatggagcccgtacggaccacagtggcgga |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
397 |
gacaccgttttcaccaaccgtgatccccctgctgccggaaaagcagctacatacggtggctcagatatatcatggagcccgtacggaccacagtggtgga |
298 |
T |
 |
| Q |
218 |
tgctgaggaaagtttgtggggtgaggatg |
246 |
Q |
| |
|
|||||||||||||||||| ||||| |||| |
|
|
| T |
297 |
tgctgaggaaagtttgtgtggtgaagatg |
269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University