View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13845_high_6 (Length: 246)
Name: NF13845_high_6
Description: NF13845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13845_high_6 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 45671840 - 45671591
Alignment:
| Q |
1 |
tcatcatgtcatggctgccagtgctgttgaacttcttactgacttggtcaaggctttacaggcagtcaatgctactgcatggcacaatgcttttttaggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45671840 |
tcatcatgtcatggctgccagtgctgttgaacttcttactgacttggtcaaggctttacaggcagtcaatgctactgcatggcacaatgcttttttaggt |
45671741 |
T |
|
| Q |
101 |
ttatggtttgctgccctgcgactcgttcaaagggtaagaaatactaac----ttcagccaattgattaactcaaatatgttctggttgctcatttatgtg |
196 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45671740 |
ttatggtttgctgccctgcggctcgttcaacgggtaagaaatactaacttgtttcagccaattgattaactcaaatctgttctggttgctcatttatgtg |
45671641 |
T |
|
| Q |
197 |
ccagacactgcattgtccacgagcttacaaatgtgtaacatgtggtcaaa |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45671640 |
ccagacactgcattgtccacgagcttacaaatgtgtaacatgtggtcaaa |
45671591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University