View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13846_high_10 (Length: 252)
Name: NF13846_high_10
Description: NF13846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13846_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 10 - 232
Target Start/End: Original strand, 53306978 - 53307200
Alignment:
| Q |
10 |
ataattctagagggttttgtatcaacttattcatggtttcaatttctttctttgatcatttattttnnnnnnntttcgtacagggtttgtatcaatttac |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
53306978 |
ataattctagagggttttgtatcaacttattcatggtttcaatttctttctttgatcatttattttaaatttttttggtacagggtttgtatcaatttac |
53307077 |
T |
 |
| Q |
110 |
tatttcttcgagtgaatttgtgttttgcacgttccacttcatatactacttgaattcattgcttgtaannnnnnnnnnnnnnnagtgatcgagcaaatta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
53307078 |
tatttcttcgagtgaatttgtgttttgcacgttccacttcatatactacttgaattcattgcttgtaattttattagatttttagtgatcgagcaaatta |
53307177 |
T |
 |
| Q |
210 |
aacgcattactttgggtctctaa |
232 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
53307178 |
aacgcattactttgggtctctaa |
53307200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University