View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13846_low_10 (Length: 345)
Name: NF13846_low_10
Description: NF13846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13846_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 14 - 332
Target Start/End: Original strand, 30944771 - 30945090
Alignment:
| Q |
14 |
attattctccaccatcctccattctctagtataccccacttatagctatctttagtgaacaagatccttgcaaggggtgatttgatattagtactaatta |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30944771 |
attattctccaccatcctccattctctagtataccccacttatagctatctttagtgaacaagatccttgcaaggggtgatttgatattagtactaatta |
30944870 |
T |
 |
| Q |
114 |
tttttcttttctccactagctatgttttgtttgtttcaccatgcatgcatgtaccttgattagatcatgtcttctatag-ttcatcaaaaaattgtacta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30944871 |
tttttcttttctccactagctatgttttgtttgtttcaccatgcatgcatgtaccttgattagatcatgtcttctatagtttcatcaaaaaattgtacta |
30944970 |
T |
 |
| Q |
213 |
taatttttaagtattttggaaagaaaccaaagtattttgtttggttaggcgaatgcttgagctttgtgcttcccgtcatttcacgtgttttgtcggtttt |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30944971 |
taatttttaagtattttggaaagaaaccaaagtattttgtttggttaggcgaatgcttgagctttgtgcttcccgtcatttcacgtgttttgtcggtttt |
30945070 |
T |
 |
| Q |
313 |
taattcaaagtgaaaattga |
332 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30945071 |
taattcaaagtgaaaattga |
30945090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University