View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13846_low_14 (Length: 243)
Name: NF13846_low_14
Description: NF13846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13846_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 233
Target Start/End: Original strand, 47456184 - 47456399
Alignment:
| Q |
18 |
tatacctcagaggaacaaaacatgtgtgaggaaagcagtggaggagcttctgcagcatctaaatcaactgtgtctctcaactccaatggaaagaaaagag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47456184 |
tatacctcagaggaacaaaacatgtgtgaggaaaacagtggaggagcttctgcagcatctaaatcaactgtgtctctcaactccaatggaaaaaaaagag |
47456283 |
T |
 |
| Q |
118 |
ctagtagaggatcagcaacagatcctcaaagcctttatgcaagggtaattatcaatttctttataagtacaaatgccttttgtttaactattcctctttt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47456284 |
ctagtagaggatcagcaacagatcctcaaagcctttatgcaagggtaattatcaatttctttataagtacaaatgccttttgtttaactattcctctttt |
47456383 |
T |
 |
| Q |
218 |
taatctccattctgtg |
233 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
47456384 |
taatctccattctgtg |
47456399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 91 - 168
Target Start/End: Complemental strand, 5272664 - 5272587
Alignment:
| Q |
91 |
ctctcaactccaatggaaagaaaagagctagtagaggatcagcaacagatcctcaaagcctttatgcaagggtaatta |
168 |
Q |
| |
|
|||||||||| ||||| |||| |||||||||||||||||| ||||||||||| ||||| || |||||||||||||||| |
|
|
| T |
5272664 |
ctctcaactcaaatgggaagacaagagctagtagaggatctgcaacagatccccaaagtctatatgcaagggtaatta |
5272587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University