View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13847_low_5 (Length: 227)
Name: NF13847_low_5
Description: NF13847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13847_low_5 |
 | |
|
| [»] scaffold0011 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0011 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 240779 - 240553
Alignment:
| Q |
1 |
ttggatgatttatttcacatgggatagctgacttgtgagacactttaccaatatagaatacgacttgcactttgctcatattgcaatcttccgagtctca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
240779 |
ttggatgatttatttcacatgggatagctgacttgtgagacactttaccaatatagaatacgacttgcactttgctcatattgcaatcttccgagtctca |
240680 |
T |
|
| Q |
101 |
gttttggtaaaattttagcaccttagttaaatagagacataaaatagaacaatacagcaaattccatgtgtgaagccgataagagtgtaacacctaaatt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
240679 |
gttttggtaaaattttagcaccttagttaaatagagacataaaatagaacaatacagcaaattccatgtgtgaagccgataagagtgtaacacctaaatg |
240580 |
T |
|
| Q |
201 |
tgaaagcaaagtaaaatggatttaatt |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
240579 |
tgaaagcaaagtaaaatggatttaatt |
240553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University