View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13848_high_1_N (Length: 421)
Name: NF13848_high_1_N
Description: NF13848
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13848_high_1_N |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 155; Significance: 4e-82; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 155; E-Value: 4e-82
Query Start/End: Original strand, 2 - 160
Target Start/End: Complemental strand, 37887429 - 37887271
Alignment:
| Q |
2 |
cttattatttcgatagattataatcttggatcacttacccatagaatttattaatttaaacatctcttttaataaacaaacttgtagcttaagaatgagg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37887429 |
cttattatttcgatagattataatcttggatcacttacccatagaatttattaatttaaacatctcttttaataaacaaacttgtagcttaagaatgagg |
37887330 |
T |
|
| Q |
102 |
tcgaatgataactatttggtgaaaaatataaattaccgcagtatatggtcacacaaaaa |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37887329 |
tcgaatgataactatttggtgaaaaatataaattaccgcagaatatggtcacacaaaaa |
37887271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 313 - 386
Target Start/End: Complemental strand, 37887106 - 37887033
Alignment:
| Q |
313 |
acgagcttgttgctctggttgatacggcaaaaccactggtttataataaaatatttaatttatatacatgatat |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37887106 |
acgagcttgttgctctggttgatacggcaaaaccactggtttataataaaatatttaatttatatacatgatat |
37887033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University