View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13849_high_19 (Length: 391)
Name: NF13849_high_19
Description: NF13849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13849_high_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 4e-66; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 4e-66
Query Start/End: Original strand, 19 - 146
Target Start/End: Complemental strand, 12703844 - 12703717
Alignment:
| Q |
19 |
gtggttacttgatttttagattgaaatgcttgcatatattagcatgtttgcttctttggtcttccatatccgctgtttgaaatcgttgttttggttcttt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12703844 |
gtggttacttgatttttagattgaaatgcttgcatatattagcatgtttgcttctttggtcttccatatccgctgtttgaaatcgttgttttggttcttt |
12703745 |
T |
 |
| Q |
119 |
aaagctccgtttcgatttggatacgccc |
146 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
12703744 |
aaagctccgtttcgatttggatacgccc |
12703717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 248 - 383
Target Start/End: Complemental strand, 12703618 - 12703480
Alignment:
| Q |
248 |
ttcaactatctctcatgcttgttttggcggtgctatgaagttcaaagaca---attggaagttggtaaagagagaagattatgagaatgaacaacttgaa |
344 |
Q |
| |
|
|||||||| ||||||||| ||||||| |||||||||||||| ||||||| || |||||||| ||| | | ||||||||||||||||||||||||||| |
|
|
| T |
12703618 |
ttcaactacctctcatgcaagttttggtggtgctatgaagttaaaagacattaatgggaagttgctaatgggtgaagattatgagaatgaacaacttgaa |
12703519 |
T |
 |
| Q |
345 |
aggagtggtattactgaggaacttgaccaacctgtctct |
383 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12703518 |
aggagtggtattactgaggaacttgaacaacctgtctct |
12703480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 321 - 390
Target Start/End: Complemental strand, 8207427 - 8207358
Alignment:
| Q |
321 |
gattatgagaatgaacaacttgaaaggagtggtattactgaggaacttgaccaacctgtctctgctcctc |
390 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || ||||||||||| |||||||||| | |||||| |
|
|
| T |
8207427 |
gattatgagaatgaacaactcgaaaggagtggtataaccgaggaacttgaacaacctgtctgttctcctc |
8207358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 62 - 139
Target Start/End: Complemental strand, 8207740 - 8207663
Alignment:
| Q |
62 |
atgtttgcttctttggtcttccatatccgctgtttgaaatcgttgttttggttctttaaagctccgtttcgatttgga |
139 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| ||||||| |||||| |||| |||||||| ||||||| |||||||| |
|
|
| T |
8207740 |
atgtttgcttctttggtcttccgtatgcgctatttgaaaatgttgttatggtgctttaaagatccgtttggatttgga |
8207663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University