View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13849_high_26 (Length: 253)
Name: NF13849_high_26
Description: NF13849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13849_high_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 117 - 246
Target Start/End: Complemental strand, 5867726 - 5867597
Alignment:
| Q |
117 |
ttgcaatcatagataattgtaatcaaaattgcaatttcaaccttaaagtaactacaaccgtaatcagaacaatgcaactttagatgattcatgataaaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5867726 |
ttgcaatcatagataattgtaatcaaaattgcaatttcaaccttaaagaaactacagccgtaatcagaacaatgcaactttagataattcatgataaaat |
5867627 |
T |
 |
| Q |
217 |
tgaatcaaattgaattgaaattaacctttg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5867626 |
tgaatcaaattgaattgaaattaacctttg |
5867597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 18 - 77
Target Start/End: Complemental strand, 5867780 - 5867721
Alignment:
| Q |
18 |
cttaatataatgaaaaactatagttaattacagccaatgcatcagtaactacaattgcaa |
77 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5867780 |
cttaatataatgaaaaactatagttaattacagccaatgcatcagtaactacaattgcaa |
5867721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University