View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13849_high_29 (Length: 211)
Name: NF13849_high_29
Description: NF13849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13849_high_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 57; Significance: 5e-24; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 57; E-Value: 5e-24
Query Start/End: Original strand, 18 - 148
Target Start/End: Complemental strand, 14781935 - 14781808
Alignment:
| Q |
18 |
caaaggggaggtggaaaagaaccttgattttcaacaacca----ttgcacccnnnnnnnttaaggatttcattaatataatgcgtgaatttagtgaatat |
113 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||| || ||||||||| |
|
|
| T |
14781935 |
caaaagggaggtggaaaagaacctcgattttcaacaaccacaacttgcacccaaaaaa-ttaaggatttcattaatataatgtgt------agtgaatat |
14781843 |
T |
 |
| Q |
114 |
tgcaatttcataaaagtagttaaccaaatgccaac |
148 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
14781842 |
tgcaatttcataaaagtagttaaccaaatgccaac |
14781808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University