View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13849_low_32 (Length: 238)
Name: NF13849_low_32
Description: NF13849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13849_low_32 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 238
Target Start/End: Original strand, 28505828 - 28506051
Alignment:
| Q |
15 |
caccaccattcgagacaaaccgaaacgcaagttggaattgctagcgaaagcaatgaggaccaccctttaatgcaatctaaacttggtgaaatccatgact |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28505828 |
caccaccattcgagacaaaccgaaacgcaagttggaatcgctagcgaaagcaatgaggaccaccctttaatgcaatctaaacttggtgaaatccatgact |
28505927 |
T |
|
| Q |
115 |
ttttataaacactagagaagtataaaaaagatgaaagtaaaataacaaggtttaaatttgtcaaaaccattgctattgacacccctgcaatccccatttg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28505928 |
ttttataaacactagagaagtataaaaaagatgaaagtaaaataacaaggtttaaatttgtcaaaaccattgctattgacacccctgcaatccccatttg |
28506027 |
T |
|
| Q |
215 |
gaaatgaaccactaagagaaaatt |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
28506028 |
gaaatgaaccactaagagaaaatt |
28506051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 15 - 57
Target Start/End: Complemental strand, 2990411 - 2990369
Alignment:
| Q |
15 |
caccaccattcgagacaaaccgaaacgcaagttggaattgcta |
57 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
2990411 |
caccaccattcgagacaaaccgaaatgcagcttggaattgcta |
2990369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 107 - 220
Target Start/End: Complemental strand, 51874912 - 51874799
Alignment:
| Q |
107 |
ccatgactttttataaacactagagaagtataaaaaagatgaaagtaaaataacaaggtttaaatttgtcaaaaccattgctattgacacccctgcaatc |
206 |
Q |
| |
|
|||||| | ||||||||||| ||||| ||| |||||||||||| ||||| | |||||| | ||| | ||| ||||||||||| ||||||||||| |
|
|
| T |
51874912 |
ccatgaatctttataaacacgtgagaaaaatacaaaagatgaaaggaaaatcaaaaggttgagattgaaccaaatcattgctattgccacccctgcaaca |
51874813 |
T |
|
| Q |
207 |
cccatttggaaatg |
220 |
Q |
| |
|
||||||| |||||| |
|
|
| T |
51874812 |
cccattttgaaatg |
51874799 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University