View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13850_high_17 (Length: 327)
Name: NF13850_high_17
Description: NF13850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13850_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 90 - 313
Target Start/End: Complemental strand, 13354447 - 13354223
Alignment:
| Q |
90 |
gagcacgcagtcttttaaataaatcaaattgggttgtttatgagtgtccaaggtcttcaatctttgacagaaaaagaaagaaaaccgtgaataacaatct |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
13354447 |
gagcacgcagtcttttaaataaatcaaattgggttgtttatgagtttccaaggtcttcaatctttgacagaaaaagaaagaaaacaatgaataacaatct |
13354348 |
T |
 |
| Q |
190 |
tcaagtaaga-tcataaacaaaagaaaaagtacaaaacaaagagttttctaggaagactgtcccaaaacagcaatcggtgagctcaacagagcttcgaac |
288 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
13354347 |
tcaagtaagattcataaacaaaagaaaaagtaccaaacaaagagttttctgggaagactgtcccaaaacagcaatctgtgagctcaacagagcttcgaac |
13354248 |
T |
 |
| Q |
289 |
aggtgaagctcatactagaggaaga |
313 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
13354247 |
tggtgaagctcatactagaggaaga |
13354223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University