View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13850_high_19 (Length: 297)
Name: NF13850_high_19
Description: NF13850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13850_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 91 - 283
Target Start/End: Original strand, 12609982 - 12610174
Alignment:
| Q |
91 |
atcatatcaaccgatcctgctcataatcttagcgatgcttttcaacaacgattcacaaaaacccctactttggttaatggtttctccaatctctatgcta |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12609982 |
atcatatcaaccgatcctgctcataatcttagcgatgcttttcaacaacgattcacaaaaacccctactttggttaatggtttctccaatctctatgcta |
12610081 |
T |
 |
| Q |
191 |
tggtttgtttcactctctcactcactcttaccctttttgaaattttcaattttttcattgcgaaagtgttgaattttgcttcttgtggtgatt |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12610082 |
tggtttgtttcactctctcactcactcttaccctttttgaaattttcaattttttcattgcgaaagtgttgaattttgcttcttgtggtgatt |
12610174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 14 - 49
Target Start/End: Original strand, 12609905 - 12609940
Alignment:
| Q |
14 |
gcaaaggtggtgttggaaaaacaacatgcagttcca |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
12609905 |
gcaaaggtggtgttggaaaaacaacatgcagttcca |
12609940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University