View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13850_high_20 (Length: 296)
Name: NF13850_high_20
Description: NF13850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13850_high_20 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 9e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 9e-36
Query Start/End: Original strand, 31 - 146
Target Start/End: Complemental strand, 47010051 - 47009935
Alignment:
| Q |
31 |
ttcttcttctataccacctcctactctcacatttacaaccctcattgttgtttttggatcttacgtttttggaactgttgtaagt-ttttcaccattttc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| | | ||||||||| ||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
47010051 |
ttcttcttctataccacctcctactctcacatttaccacccttgtagctgtttttggttcttacgtttttggaactgctgtaagttttttcaccattttc |
47009952 |
T |
|
| Q |
130 |
tttctaactttataaca |
146 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
47009951 |
tttctatctttataaca |
47009935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University