View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13850_high_22 (Length: 288)

Name: NF13850_high_22
Description: NF13850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13850_high_22
NF13850_high_22
[»] chr4 (2 HSPs)
chr4 (1-61)||(6954360-6954421)
chr4 (139-190)||(6954532-6954583)


Alignment Details
Target: chr4 (Bit Score: 54; Significance: 5e-22; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 1 - 61
Target Start/End: Original strand, 6954360 - 6954421
Alignment:
1 aatttgacatgaaatttt-gttgatgcttttgatgaaaactcgccagagaactcaaaccaaa 61  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
6954360 aatttgacatgaaatttttgttgatgcttttgatgaaaactcgccagagaactcaaaccaaa 6954421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 139 - 190
Target Start/End: Original strand, 6954532 - 6954583
Alignment:
139 gatgaaaacaaaaactaggtttcttggagagcaagtgacggcaaactaggtt 190  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||    
6954532 gatgaaaacaaaaactaggtttcttggagagcaagtgacggaaaactaggtt 6954583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University