View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13850_low_21 (Length: 334)
Name: NF13850_low_21
Description: NF13850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13850_low_21 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 19 - 305
Target Start/End: Original strand, 11264479 - 11264766
Alignment:
| Q |
19 |
gtgatttgtatgttacatgtgtttgaatgtgtcacttttatgctagagttagatactaaaatatttatttattgggggcttgtgttttggatggatatct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11264479 |
gtgatttgtatgttacatgtgtttgaatgtgtcacttatatgctagagttagatactaaaatatttatttattgggggcttgtgttttgaatggatatct |
11264578 |
T |
|
| Q |
119 |
tgggctataatttttcacctaatgaggagatccttacc--nnnnnnnnngtagaaagaaagagatccttaccttttgtgtgctcctaaattatgcatatt |
216 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
11264579 |
taggctataatttttcacctaatgaggagatccttacctttttttttttgtagaaagaaagagatccttaccttttgtgtgctactaaattatgcata-t |
11264677 |
T |
|
| Q |
217 |
ttttaaacgtggtcttgaagttgannnnnnnactatgcccctaaagaattaaattaatgtggtcaaaagttttatgttggtttttgtaa |
305 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11264678 |
ttttaaacgtggtcctgaagttgatttttttactatgcccctaaagaattaaattaatgtggtcaaaagttttatgttggtttttgtaa |
11264766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University