View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13850_low_33 (Length: 205)
Name: NF13850_low_33
Description: NF13850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13850_low_33 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 42218951 - 42218795
Alignment:
| Q |
18 |
caaaggggaaattgaactatactagaacacaataactatgcattccataaagatacttaccagaaacccttatcagtaagctaatccagcaaaggcacat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
42218951 |
caaaggggaaattgaactatactagaacccaataattatgcattccataaagatacttaccagaaacccttatcagtaagctaatccagcaaaggcata- |
42218853 |
T |
|
| Q |
118 |
gcaaaatggagttgcaaaattgcatttagggagtagggtcatcaaagcacaaaagatattattagaataa |
187 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
42218852 |
------------tgcaaaatagcatttagggagtagggtcatcaaagcacaaaagatactattagaataa |
42218795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University