View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13850_low_33 (Length: 205)

Name: NF13850_low_33
Description: NF13850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13850_low_33
NF13850_low_33
[»] chr3 (1 HSPs)
chr3 (18-187)||(42218795-42218951)


Alignment Details
Target: chr3 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 18 - 187
Target Start/End: Complemental strand, 42218951 - 42218795
Alignment:
18 caaaggggaaattgaactatactagaacacaataactatgcattccataaagatacttaccagaaacccttatcagtaagctaatccagcaaaggcacat 117  Q
    |||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |     
42218951 caaaggggaaattgaactatactagaacccaataattatgcattccataaagatacttaccagaaacccttatcagtaagctaatccagcaaaggcata- 42218853  T
118 gcaaaatggagttgcaaaattgcatttagggagtagggtcatcaaagcacaaaagatattattagaataa 187  Q
                |||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||    
42218852 ------------tgcaaaatagcatttagggagtagggtcatcaaagcacaaaagatactattagaataa 42218795  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University