View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13851_low_16 (Length: 254)
Name: NF13851_low_16
Description: NF13851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13851_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 4 - 237
Target Start/End: Complemental strand, 18030000 - 18029767
Alignment:
| Q |
4 |
aggaggagcagagaaagaagaagagtacaaagaaccacgagtttcaaagaagaaaacacagtctccgtgggatttcacaaaatactcggaatcagtagcc |
103 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18030000 |
aggagtagaagagaaagaagaagagtacaaagaaccacgagtttcaaagaagaaaacacagtctccgtgggatttcacaaaatactcggaatcagtagcc |
18029901 |
T |
 |
| Q |
104 |
gaagaacatgctcgcaggagtacaacctctgtagacgacaaaatctatgccgttagacaacgtgccatgcccattgttgctttgcccgacaccgatgact |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
18029900 |
gaagaacatgctcgcaggagtacaacctctgtagacgacaaaatctatgccgttagacaacgtgccatgcccattgttgctttccccgacaccgatgact |
18029801 |
T |
 |
| Q |
204 |
acagtaactctgactctgaacctgataatcaagt |
237 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
18029800 |
acagtaactctgactctgaacctgataaacaagt |
18029767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 31 - 149
Target Start/End: Complemental strand, 19680156 - 19680038
Alignment:
| Q |
31 |
caaagaaccacgagtttcaaagaagaaaacacagtctccgtgggatttcacaaaatactcggaatcagtagccgaagaacatgctcgcaggagtacaacc |
130 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||| ||||| ||||| ||||||| |||||||| || |||||||| |||||| |||||||||| |
|
|
| T |
19680156 |
caaagaaccgcgagtttcgaagaagaaaacacagtctccatgggacttcactcaatactctgaatcagttgctgaagaacacgctcgccggagtacaaca |
19680057 |
T |
 |
| Q |
131 |
tctgtagacgacaaaatct |
149 |
Q |
| |
|
|| |||||||| ||||||| |
|
|
| T |
19680056 |
tcagtagacgataaaatct |
19680038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University