View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13851_low_19 (Length: 235)
Name: NF13851_low_19
Description: NF13851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13851_low_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 139
Target Start/End: Original strand, 29932163 - 29932301
Alignment:
| Q |
1 |
ctcaacacactcgttcctagtgggaataggctatggtaatttagcgtccagtccaaaagtaagtaaattctagtaaaaagttgttctagtcagaatcgaa |
100 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29932163 |
ctcaacactctcgttcctagcgggaataggctatggtaatttagtgttcggtccaaaagtaagtaaattctagtaaaaagttgttctagtcagaatcgaa |
29932262 |
T |
|
| Q |
101 |
acaagtgaatcaataaattaccactaagaataaattttg |
139 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29932263 |
acaagtgaatcaataagttaccactaagaataaattttg |
29932301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University