View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13854_high_11 (Length: 243)
Name: NF13854_high_11
Description: NF13854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13854_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 36009179 - 36008953
Alignment:
| Q |
1 |
ataggaaagaccactctagcagctaaagctataaacagtgtagaaaaagcgatgtctttgtccatttcttgttctaccaccaagccatatttgaaggtcg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36009179 |
ataggaaagaccactctagcagctaaagctataaacagtgtagaaaaagctatgtctttttccatttcttgttctaccaccaagccatatttgaaggtcg |
36009080 |
T |
|
| Q |
101 |
acaccaaaatcaaaattcaacaacagataccaaatatttcagtagcattgcccgggtcatgtgaaccaaaagactcatcagatcatgagaatgagttgca |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
36009079 |
acaccaaaatcaaaattcaacaatagataccaaatatttcagtagcattgccgaggtcatgtgaatcaaaagactcatcagatcatgggaatgagttgca |
36008980 |
T |
|
| Q |
201 |
agaaaaacgttcgaagctgcataaagg |
227 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
36008979 |
agaaaaacgttcgaagctggataaagg |
36008953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University