View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13854_high_12 (Length: 241)
Name: NF13854_high_12
Description: NF13854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13854_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 10303179 - 10302954
Alignment:
| Q |
1 |
ttttgtccctagattgtcatggaacctcttagtgtatctttggatgaagaccttaacaatgcagctaaacaagttgaggtataaactttatcnnnnnnnc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10303179 |
ttttgtccctagattgtcatggaacctcttagtgtatctttggatgaagaccttaacaatgcagctaaacaagttgaggtataaactttatctttttttc |
10303080 |
T |
 |
| Q |
101 |
cttcatatattccaacttcaatccctgcccttgccactttcttgtttccacattcagtttttagtagctcttattttctgaaatgattattacttgatag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10303079 |
cttcatatattccaacttcaatccctgcccttgccacttgcttgtttccacattcagtttttagtagctcttattttctgaaatgattattacttgatag |
10302980 |
T |
 |
| Q |
201 |
gatgatatgaagtcaaaagaggaagc |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
10302979 |
gatgatatgaagtcaaaagaggaagc |
10302954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 1 - 82
Target Start/End: Complemental strand, 38425348 - 38425267
Alignment:
| Q |
1 |
ttttgtccctagattgtcatggaacctcttagtgtatctttggatgaagaccttaacaatgcagctaaacaagttgaggtat |
82 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| ||| ||||||||||||| ||| ||| ||||||||| ||||||||| |
|
|
| T |
38425348 |
ttttgttcctagattgtcatggaacctcttagtgtttctgtggatgaagacctcaacgatggggctaaacaatttgaggtat |
38425267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University