View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13854_low_10 (Length: 336)
Name: NF13854_low_10
Description: NF13854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13854_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 180 - 317
Target Start/End: Original strand, 2661253 - 2661390
Alignment:
| Q |
180 |
ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttata |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661253 |
ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacaaagggaattggaatgaagctgcttgagaagatgggttata |
2661352 |
T |
 |
| Q |
280 |
aagggggtggtcttgggaagaatgagcagggtatttta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661353 |
aagggggtggtcttgggaagaatgagcagggtatttta |
2661390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 11 - 105
Target Start/End: Original strand, 2661081 - 2661175
Alignment:
| Q |
11 |
taattctggtcgtggtgtgaatggttcagataggaatgatgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcgtttg |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661081 |
taattctggtcgtggtgtgaatggttcagataggaatgatgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcgtttg |
2661175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 188 - 313
Target Start/End: Original strand, 25951995 - 25952117
Alignment:
| Q |
188 |
gggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggt |
287 |
Q |
| |
|
|||| ||||||||||||| || || ||||||||||||||| ||||| ||| | ||||| |||||||||||| | ||||| |||||||||||||| ||| |
|
|
| T |
25951995 |
gggtctaggtcaggagggatcagttgatgttgggaaattcaagagttata---acggaatgggaatgaagctgatggagaaaatgggttataaaggaggt |
25952091 |
T |
 |
| Q |
288 |
ggtcttgggaagaatgagcagggtat |
313 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25952092 |
ggtcttgggaagaatgagcagggtat |
25952117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 193 - 313
Target Start/End: Original strand, 25945404 - 25945521
Alignment:
| Q |
193 |
taggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggtggtct |
292 |
Q |
| |
|
||||||| |||| || ||||||||||||||||| |||| | ||| || ||||| |||||||||||| | ||||| |||||||||||||| |||||||| |
|
|
| T |
25945404 |
taggtcacgaggaatcagtggatgttgggaaattggagaat--tac-aacggaatgggaatgaagctgatggagaaaatgggttataaaggaggtggtct |
25945500 |
T |
 |
| Q |
293 |
tgggaagaatgagcagggtat |
313 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
25945501 |
tgggaagaatgagcagggtat |
25945521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University