View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13854_low_10 (Length: 336)

Name: NF13854_low_10
Description: NF13854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13854_low_10
NF13854_low_10
[»] chr8 (2 HSPs)
chr8 (180-317)||(2661253-2661390)
chr8 (11-105)||(2661081-2661175)
[»] chr7 (2 HSPs)
chr7 (188-313)||(25951995-25952117)
chr7 (193-313)||(25945404-25945521)


Alignment Details
Target: chr8 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 180 - 317
Target Start/End: Original strand, 2661253 - 2661390
Alignment:
180 ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttata 279  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
2661253 ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacaaagggaattggaatgaagctgcttgagaagatgggttata 2661352  T
280 aagggggtggtcttgggaagaatgagcagggtatttta 317  Q
    ||||||||||||||||||||||||||||||||||||||    
2661353 aagggggtggtcttgggaagaatgagcagggtatttta 2661390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 11 - 105
Target Start/End: Original strand, 2661081 - 2661175
Alignment:
11 taattctggtcgtggtgtgaatggttcagataggaatgatgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcgtttg 105  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2661081 taattctggtcgtggtgtgaatggttcagataggaatgatgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcgtttg 2661175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 64; Significance: 6e-28; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 188 - 313
Target Start/End: Original strand, 25951995 - 25952117
Alignment:
188 gggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggt 287  Q
    |||| ||||||||||||| || || ||||||||||||||| ||||| |||   | ||||| |||||||||||| | ||||| |||||||||||||| |||    
25951995 gggtctaggtcaggagggatcagttgatgttgggaaattcaagagttata---acggaatgggaatgaagctgatggagaaaatgggttataaaggaggt 25952091  T
288 ggtcttgggaagaatgagcagggtat 313  Q
    ||||||||||||||||||||||||||    
25952092 ggtcttgggaagaatgagcagggtat 25952117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 193 - 313
Target Start/End: Original strand, 25945404 - 25945521
Alignment:
193 taggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggtggtct 292  Q
    ||||||| ||||  || ||||||||||||||||| |||| |  ||| || ||||| |||||||||||| | ||||| |||||||||||||| ||||||||    
25945404 taggtcacgaggaatcagtggatgttgggaaattggagaat--tac-aacggaatgggaatgaagctgatggagaaaatgggttataaaggaggtggtct 25945500  T
293 tgggaagaatgagcagggtat 313  Q
    |||||||||||||||||||||    
25945501 tgggaagaatgagcagggtat 25945521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University