View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13854_low_11 (Length: 265)
Name: NF13854_low_11
Description: NF13854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13854_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 34097805 - 34098033
Alignment:
| Q |
19 |
tttgaaaacaagatgcatgttaatataaggagttaaaaagtgtttctttttccatgtagtaagagttgtatggcagagtggctgcctgtggcaaacatgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34097805 |
tttgaaaacaagatgcatgttaatataaggagttaaaaagtgtttctttttccatgtagtaagagttgtatggcagagtggctgcctgtggcaaacatgc |
34097904 |
T |
|
| Q |
119 |
tatatctctttgttctacttattatgaccacctttttaccttttaacttttctgtaatctctcttctttaggtaaaactgcaccctaatatctctcccta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34097905 |
tatatctctttgttctacttattatgaccacctttttaccttttaacttttctgtaatctctcttctttaggtaaaactgcaccctaatatctctcccta |
34098004 |
T |
|
| Q |
219 |
tgttctcttttcttactcacagttcaaac |
247 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34098005 |
tgttctcttttcttactcacagttcaaac |
34098033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University