View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13854_low_13 (Length: 250)
Name: NF13854_low_13
Description: NF13854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13854_low_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 10303175 - 10303408
Alignment:
| Q |
1 |
caaaacagtccacaaacacagaaagggaaaaatgaaagggaggaacaagattagtggaggatacaaaataaaaggggaatccacaaattaatagaactta |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10303175 |
caaaacagtccacaaacacagaaatggaaaaatgaaagggtggaacaagattagtggaggatacaaaataaaaggggaatccacaaattaatagaactta |
10303274 |
T |
 |
| Q |
101 |
tgtccctatatacacactgaaactcatgcatgcatgaggagttcggttcccaaacttgatacaagtcatagtgacacaagtcaaacagttattaaacaga |
200 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
10303275 |
tgta-------acacactgaaactcatgcatgcatgaggagttgggttcccaaacttgatacaagtcatagtgacacaagttaaacagttattaaacaga |
10303367 |
T |
 |
| Q |
201 |
cttacatctttcaatcgtgggaatgttgattcaatattctt |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10303368 |
cttacatctttcaatcgtgggaatgttgattcaatcttctt |
10303408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University