View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13855_high_1 (Length: 424)
Name: NF13855_high_1
Description: NF13855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13855_high_1 |
 |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 1e-88; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 243 - 416
Target Start/End: Original strand, 31039674 - 31039847
Alignment:
| Q |
243 |
catcaccgcatacctaaaagagcgctgaccaagccgccagcactgatctccagtgaccaagaatcctcgcctttcctaacagctgaaactggcaatctat |
342 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31039674 |
catcaccgcatacctaaaagagcgctgaccaagccgccagcactgatctccagagaccaagaatcctcgcctttcctaacagctgaaactggcaatctat |
31039773 |
T |
 |
| Q |
343 |
tagccacaaccaaaagccgttgtctaacaggttttccatcttccctttcatatccattactaagaacctttgct |
416 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
31039774 |
tagccacaaccaaaagccgttgtctaacaggttttccatcttccctttcatatccattactaagagcctttgct |
31039847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 18 - 174
Target Start/End: Original strand, 31039448 - 31039604
Alignment:
| Q |
18 |
gatattgctacaaaatgtagactaatgtggtcacaattgcaatgccattgcagagaccttgcaaaccacaatttagacagatggcccaaattcatttcca |
117 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
31039448 |
gatattgctataaaatgtagactaatgtggtcacaattgcaatgccattgcagagaccttgcaaaccacaatttagaccgatggcccaaattcatttcca |
31039547 |
T |
 |
| Q |
118 |
aatgcaacaaacttaattgaaacccatcctcaaaaaccaataacagttaaattcatg |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31039548 |
aatgcaacaaacttaattgaaacccatcctcaaaaaccaataacagttaaattcatg |
31039604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 250 - 365
Target Start/End: Original strand, 93688 - 93803
Alignment:
| Q |
250 |
gcatacctaaaagagcgctgaccaagccgccagcactgatctccagtgaccaagaatcctcgcctttcctaacagctgaaactggcaatctattagccac |
349 |
Q |
| |
|
||||||||| ||||| ||||| | ||| || ||||||||||| | ||||||||||| || ||| ||||| || || || ||||||||||| ||||| |
|
|
| T |
93688 |
gcatacctaggagagcactgacgaggccacctgcactgatctctaaagaccaagaatcttcacctgtcctatttgccgacacaggcaatctatttgccac |
93787 |
T |
 |
| Q |
350 |
aaccaaaagccgttgt |
365 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
93788 |
aaccaaaagcctttgt |
93803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University