View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13855_high_2 (Length: 321)
Name: NF13855_high_2
Description: NF13855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13855_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 5e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 24 - 319
Target Start/End: Original strand, 28140118 - 28140408
Alignment:
| Q |
24 |
ttcattattatttgcttaaaatgtagggagacaatatttttcttataatacatgttgatatgataataacttatatgtttgaatttcaatttattattaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
28140118 |
ttcattattatttgcttaaaatgtagggagacaatatttttcttataatacatct-----tgataataacttatatgttttaatttcagtttattattaa |
28140212 |
T |
 |
| Q |
124 |
ctannnnnnncattaaacactatccaagatatccgcaaggacagagaagaaaaactccctagggtggagagcgaggaggtgaataaaacgggggatggga |
223 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
28140213 |
ctatttttttcattaaacactatccaagatatccgcaaggaaagagaagaaaaacttcctagggtggagagcgaggaggtaaataatacgggggatggga |
28140312 |
T |
 |
| Q |
224 |
gcgagaaagtgctcccacctttcgtttagttgtcctccatttctttgtttcattatgttggcaaccgttttttcctgccccgattagacatgtcat |
319 |
Q |
| |
|
|||||||||| |||||| || ||| ||||| | ||||| ||||||||||||||||||| || || ||||||||| |||| ||| ||||||||| |
|
|
| T |
28140313 |
gcgagaaagtactcccaactctcgcccagttgacatccatatctttgtttcattatgttgacaccctttttttcctacccctattgtacatgtcat |
28140408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University