View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13855_high_4 (Length: 272)
Name: NF13855_high_4
Description: NF13855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13855_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 238; Significance: 1e-132; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 41558303 - 41558568
Alignment:
| Q |
1 |
tattcatgttctctaggttttgagnnnnnnnngttattttgcttttagatgtgatgttgagagttctggtgattgttcagaagcttttacaagagaacaa |
100 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41558303 |
tattcctgttctctaggttttgagttttttttgttattttgcttttagatgtgatgttgagagttctggtgattgttcagaagcttttacaagagaacaa |
41558402 |
T |
 |
| Q |
101 |
acatagttcaaaaagagacatttattacatgcatccatctgtctttttgggtgagtcatcagaatttcgcaacatgatggatcatatggatactaacact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41558403 |
acatagttcaaaaagagacatttattacatgcatccatctgtctttttgggtgagtcatcagaatttcgcaacatgatggatcatatggatactaacact |
41558502 |
T |
 |
| Q |
201 |
cttttagtatagttgatcttgtattgattttcaatagctaattatgactgtcatgaattatctctg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41558503 |
cttttagtatagttgatcttgtattgattttcaatagctaattatgactgtcatgaattatctctg |
41558568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 93 - 234
Target Start/End: Original strand, 41542268 - 41542409
Alignment:
| Q |
93 |
gagaacaaacatagttcaaaaagagacatttattacatgcatccatctgtctttttgggtgagtcatcagaatttcgcaacatgatggatcatatggata |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
41542268 |
gagaacaaacatagttcaaaaagagacatttattacatgcatccatctgtctttttaggcgagtagtcagaatttcgagacatgatggatcatatggata |
41542367 |
T |
 |
| Q |
193 |
ctaacactcttttagtatagttgatcttgtattgattttcaa |
234 |
Q |
| |
|
|| ||||||||| ||| |||||||||||||||||| |||| |
|
|
| T |
41542368 |
gcaatactcttttaatattgttgatcttgtattgattgtcaa |
41542409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University