View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13855_low_7 (Length: 226)
Name: NF13855_low_7
Description: NF13855
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13855_low_7 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 93 - 226
Target Start/End: Complemental strand, 31039957 - 31039824
Alignment:
| Q |
93 |
gatagtgaaaaacatgtggttactgaatcttttgagcatgacctaagcttaaaagaatgtaataactctggtgcttcccattttgaacgattcctggaag |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31039957 |
gatagtgaaaaacatgtggttactgaatcttttgagcatgacctaagcttaaaagaatgtaataactctggtgcttcccattttgaacgattcctggaag |
31039858 |
T |
 |
| Q |
193 |
gtgccgcagcagcaaaggttcttagtaatggata |
226 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||| |
|
|
| T |
31039857 |
gtgctgcagcagcaaaggctcttagtaatggata |
31039824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 31
Target Start/End: Complemental strand, 31040052 - 31040022
Alignment:
| Q |
1 |
tcaaggcatcatcacctgatattgttgttat |
31 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31040052 |
tcaaggcatcatcacctgatattgttgttat |
31040022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University