View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13856_high_13 (Length: 352)
Name: NF13856_high_13
Description: NF13856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13856_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 12 - 257
Target Start/End: Complemental strand, 17875866 - 17875621
Alignment:
| Q |
12 |
aagaatatgggtaaaaatattgttatgaatgaaaataagaacatgaatgggtctattaggtccattttcatgcatgctgatggggaagattggttcctta |
111 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17875866 |
aagaaaatgggtaaaaatattgttatgaatgaaaataagaacatgaatgggtctattaggtccattttcatgcatgctgatggggaagattggttcctta |
17875767 |
T |
 |
| Q |
112 |
tgattttaggtaccattggagcaattggtgaaggtttcaatgctcctttgattttgtatatttgtagccacatgattaacaatattggaagttcatctac |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17875766 |
tgattttaggtaccattggagcaattggtgaaggtttcaacgctcctttgattttgtatatttgtagccacatgattaacaatattggaagttcatctac |
17875667 |
T |
 |
| Q |
212 |
catggatggagacactttcatccataacatcaacaaggtcccccct |
257 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17875666 |
catggatgtagacactttcatccataacatcaacaaggtcccccct |
17875621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 57 - 93
Target Start/End: Complemental strand, 2679918 - 2679882
Alignment:
| Q |
57 |
aatgggtctattaggtccattttcatgcatgctgatg |
93 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
2679918 |
aatggttcttttaggtccattttcatgcatgctgatg |
2679882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University