View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13856_low_24 (Length: 238)
Name: NF13856_low_24
Description: NF13856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13856_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 10 - 223
Target Start/End: Original strand, 50094596 - 50094809
Alignment:
| Q |
10 |
agaagcaaagggatccaaatgctcccaaaagtgtgttgtctggattcaagttattttctcgaaaggaaagagaggtgtgttttatgttttacataccggt |
109 |
Q |
| |
|
||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50094596 |
agaagaaaagggatccaaatgctcccaagagtgtgttgtctggattcaagttattttctcgaaaggaaagagaggtgtgttttatgttttacataccggt |
50094695 |
T |
 |
| Q |
110 |
ggtgtggaaatgatcacttttcttctgtaaaattgtctaaaactgttgatggaatgaatttcaaacactgctttttcttaatgacggaatctaaagaaaa |
209 |
Q |
| |
|
|| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
50094696 |
ggcgtggaaatgatcacttttcttctataaaattgtctaaaactgttgatggaatgaatttcaaacactgctttttcttaatgacagaatctaaagaaaa |
50094795 |
T |
 |
| Q |
210 |
ctaatattgggatt |
223 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
50094796 |
ctaatattgggatt |
50094809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 10 - 97
Target Start/End: Complemental strand, 35497904 - 35497817
Alignment:
| Q |
10 |
agaagcaaagggatccaaatgctcccaaaagtgtgttgtctggattcaagttattttctcgaaaggaaagagaggtgtgttttatgtt |
97 |
Q |
| |
|
||||| ||| |||||||||||| ||||| || | |||||||||||| ||| ||||||| || |||||||||||||||||||||||| |
|
|
| T |
35497904 |
agaagaaaaaggatccaaatgcacccaagaggggaatgtctggattcatgttcttttctcaaatggaaagagaggtgtgttttatgtt |
35497817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University